Search found 133 matches
- November 29th, 2011, 12:52 am
- Forum: General Chat
- Topic: Pics or it didnt happen
- Replies: 30
- Views: 20139
Re: Pics or it didnt happen
Well no wonder she dosent want to see you again, you attempted to give her a ring from a gum ball machine!
- November 26th, 2011, 8:56 pm
- Forum: General Chat
- Topic: PSN
- Replies: 10
- Views: 7001
Re: PSN
If only everyone in the community were smart enough to not reply to these topics.
- November 23rd, 2011, 4:39 pm
- Forum: Bugs
- Topic: /mark not accurate anymore
- Replies: 4
- Views: 7325
/mark not accurate anymore
/mark or /m docent seem to be very accurate anymore. Instead of the mark being where your head is, it seems to be in a random position where your head isn't.
- November 23rd, 2011, 2:28 pm
- Forum: General Chat
- Topic: Do you belive aliens or not? xD
- Replies: 28
- Views: 16892
Re: Do you belive aliens or not? xD
Yes they do exist and I have proof. I was drivin on a country road going home. Suddenly I got a flat tire so I go out to fix it. When I got my tire off I was suddenly surrounded by bright lights. I was then in the presence of 3 green guys with glass surrounding their heads. They strangely looked lik...
- November 23rd, 2011, 1:40 am
- Forum: General Chat
- Topic: Bye
- Replies: 23
- Views: 14434
Re: Bye
I don't believe a single thing said here, except crabs story, his friend is scary.
This does remind me of patogy and his austin martin, just a fake story to make you look good or have sympathy for you.
This does remind me of patogy and his austin martin, just a fake story to make you look good or have sympathy for you.
- November 21st, 2011, 5:35 pm
- Forum: Applications
- Topic: Manson Application:Tacco199
- Replies: 35
- Views: 20030
Re: Manson Application:Tacco199
You are applying for Manson?
- November 20th, 2011, 8:13 pm
- Forum: Cities & Organizations
- Topic: League Of Assassins Faction
- Replies: 30
- Views: 28620
Re: League Of Assassins Faction
No offense but you should rename your faction, unless you are tryin to appeal to young kids.
Use a thesaurus to find cool names that also mean assassin or league.
Use a thesaurus to find cool names that also mean assassin or league.
- November 19th, 2011, 3:38 pm
- Forum: General Chat
- Topic: The World Ending?
- Replies: 278
- Views: 139071
Re: The World Ending?
So i herd you like dying in 2012, so i prepared a speech for you. http://www.diseno-art.com/images/chrysler_me412.jpg That car is the Chrysler me412. It was a concept car built in 2004. It was planned to have 200 of those cars made each year. It didn't happen. http://whollysblog.com/wp-content/uploa...
- October 26th, 2011, 4:44 am
- Forum: Entertainment
- Topic: Funny Picture Thread.
- Replies: 51
- Views: 47917
Funny Picture Thread.
Have a random urge to show us the funniest picture/gif you saw today?
Post here, not on some random thread.
Post here, not on some random thread.
- October 26th, 2011, 4:32 am
- Forum: General Chat
- Topic: The World Ending?
- Replies: 278
- Views: 139071
Re: The World Ending?
Stephen Hawking's theory: Make an invintation to anyone in the future. Invite only yourself and the person from the future, dont invite anyone else. This invintation will be a nice dinner party with you in 2 hours. You seal the invintation somewhere safe so it can be unopened, unread for a very long...
- October 24th, 2011, 9:11 pm
- Forum: Appeals
- Topic: Demotion Appeal - Facecomic
- Replies: 6
- Views: 3750
Re: Demotion Appeal - Facecomic
Every time you log in to our server, you are shown a phrase that consists of reading the /help and reading the /rules. When you enter in /rules, you are told some basic rules. You are also told to go on the internet and enter in the forums website, which can lead you to the rules here. It is up to y...
- October 23rd, 2011, 4:54 pm
- Forum: General Chat
- Topic: Lovers Of Fcraft
- Replies: 6
- Views: 4527
Re: Lovers Of Fcraft
Pointless thread is weird and pointless. We all know dreaming has a wrongful relationship with Nel.
- October 23rd, 2011, 2:26 pm
- Forum: Who are you?
- Topic: I WANT TO SEE YOU
- Replies: 861
- Views: 838403
Re: I WANT TO SEE YOU
DNA sample, or it didn't happen. tagcatcgatcgatcgatcagctagcatgcggcgcgccgatcatatcgatcagctacgac tgactgtacgcatcgatcagcatcgactacgatagactacgacgacgactacgactgctg acgtacactgactgatcgactacgatcgatcgactagctagctacgatcgatagatatagc gctcgagagagagatctcgatcagctagcatcgatcgatcgactgactgactgactctcct cgatgagagagctagcatcg...
- October 22nd, 2011, 10:27 pm
- Forum: General Chat
- Topic: Steam Trades
- Replies: 5
- Views: 4769
- October 22nd, 2011, 10:22 pm
- Forum: General Chat
- Topic: Leaving - Opposite2u
- Replies: 7
- Views: 6091
Re: Leaving - Opposite2u
Just a little comment to everyone else. You will be surprised how many people don't care about you, so don't think you'll get puppy love From others writing a good bye thread.
Just leave quietly.
Just leave quietly.
- October 22nd, 2011, 2:33 pm
- Forum: Who are you?
- Topic: I WANT TO SEE YOU
- Replies: 861
- Views: 838403
Re: I WANT TO SEE YOU
DNA sample, or it didn't happen.
- October 18th, 2011, 6:38 pm
- Forum: Technology
- Topic: Battle Stations.
- Replies: 167
- Views: 205651
Re: Battle Stations.
Wireless from my basement, and receiving from my room on the top floor.
- October 17th, 2011, 8:57 pm
- Forum: General Chat
- Topic: The World Ending?
- Replies: 278
- Views: 139071
Re: The World Ending?
The world will end when we can no longer think of stuff to invent.
- October 16th, 2011, 2:43 am
- Forum: Entertainment
- Topic: Non Mainstream Music!
- Replies: 217
- Views: 208400
Re: Non Mainstream Music!
Jesse cook:
Tempest
Mario takes a walk
Tempest
Mario takes a walk
- October 15th, 2011, 6:34 pm
- Forum: General Chat
- Topic: Best spleefer
- Replies: 11
- Views: 7638
Re: Best spleefer
Stay tuned for a new spleef event!
- October 15th, 2011, 1:52 am
- Forum: Technology
- Topic: Who else fixes their own shit?
- Replies: 28
- Views: 22339
Re: Who else fixes their own shit?
I fix everything... My past job involved general contracting. That job requires you to do drywalling, mudding, electrical work, plumbing and everything else under the sun and moon. I dont understand much about how computers work. I must of missed the episode of The Magic School Bus when they were ta...
- October 15th, 2011, 1:41 am
- Forum: Appeals
- Topic: Demotion appeal
- Replies: 3
- Views: 2787
Re: Demotion appeal
So what you are telling me is that you are making this story up about somebody letting you grief their own build. Now the story is that nobody gave you permission to grief this build. So you briefed the build out of spite. You are a builder. Being a builder requires you to have more responsibility. ...
- October 15th, 2011, 1:21 am
- Forum: Who are you?
- Topic: noze2k - here i am
- Replies: 7
- Views: 5171
Re: noze2k - here i am
As a Canadian, you speak better english than me. Unless it took you forever to iron out the kinks in your post.
As always, Welcome and have a great time.
As always, Welcome and have a great time.
- October 15th, 2011, 1:19 am
- Forum: Appeals
- Topic: Demotion appeal
- Replies: 3
- Views: 2787
Re: Demotion appeal
Before i can investigate, i ask who told you it was ok to grief, and when did they tell you?
- October 15th, 2011, 1:18 am
- Forum: General Chat
- Topic: Burger King or McDonalds? Which side are you on?
- Replies: 36
- Views: 39367
Re: Burger King or McDonalds? Which side are you on?
Sadly i choose McDonalds over Wendy's or burger king. A&W is so friggen salty, and their food is greasier than anyone out there. Wendy's used to be my choice but they slowly got worse and worse. Right now their hamburger buns are smothered in butter now. Burger king has always been the shittiest...
- October 12th, 2011, 1:25 am
- Forum: General Chat
- Topic: Trolling
- Replies: 10
- Views: 6504
Re: Trolling
And this is a good test to see who the real trolls are these days.
A serious question? was asked and well...
Congrats, you failed the test.
http://beetlesinthebush.files.wordpress ... c31516.jpg
A serious question? was asked and well...
Congrats, you failed the test.
http://beetlesinthebush.files.wordpress ... c31516.jpg
- October 11th, 2011, 9:08 pm
- Forum: SMP Server Questions & Suggestions
- Topic: Another dumb arena suggestion
- Replies: 12
- Views: 12432
Re: Another dumb arena suggestion
This was a great thread until the trolls came around.
Requesting a lock.
Requesting a lock.
- October 11th, 2011, 1:55 am
- Forum: SMP Server Questions & Suggestions
- Topic: Another dumb arena suggestion
- Replies: 12
- Views: 12432
Re: Another dumb arena suggestion
All it is, is a simple /kit that gives them the required items, and simple redstone wiring to get them into the action.
- October 11th, 2011, 12:31 am
- Forum: SMP Server Questions & Suggestions
- Topic: Another dumb arena suggestion
- Replies: 12
- Views: 12432
Another dumb arena suggestion
I saw this video on youtube and it looks very promising . It emphasizes on player strategy instead of running and smacking someone with a sword. They have come up with a class system that has different ways of fighting. A tank can take damage and heal a bit, and is capable of dealing low melee damag...
- October 10th, 2011, 12:48 pm
- Forum: General Chat
- Topic: New Temp Map?
- Replies: 14
- Views: 10574
Re: New Temp Map?
Do it!