fCraft Forums

Well no wonder she dosent want to see you again, you attempted to give her a ring from a gum ball machine!

If only everyone in the community were smart enough to not reply to these topics.

/mark or /m docent seem to be very accurate anymore. Instead of the mark being where your head is, it seems to be in a random position where your head isn't.

Yes they do exist and I have proof. I was drivin on a country road going home. Suddenly I got a flat tire so I go out to fix it. When I got my tire off I was suddenly surrounded by bright lights. I was then in the presence of 3 green guys with glass surrounding their heads. They strangely looked lik...

I don't believe a single thing said here, except crabs story, his friend is scary.
This does remind me of patogy and his austin martin, just a fake story to make you look good or have sympathy for you.

You are applying for Manson?

No offense but you should rename your faction, unless you are tryin to appeal to young kids.
Use a thesaurus to find cool names that also mean assassin or league.

So i herd you like dying in 2012, so i prepared a speech for you. http://www.diseno-art.com/images/chrysler_me412.jpg That car is the Chrysler me412. It was a concept car built in 2004. It was planned to have 200 of those cars made each year. It didn't happen. http://whollysblog.com/wp-content/uploa...

Have a random urge to show us the funniest picture/gif you saw today?
Post here, not on some random thread.

Stephen Hawking's theory: Make an invintation to anyone in the future. Invite only yourself and the person from the future, dont invite anyone else. This invintation will be a nice dinner party with you in 2 hours. You seal the invintation somewhere safe so it can be unopened, unread for a very long...

Every time you log in to our server, you are shown a phrase that consists of reading the /help and reading the /rules. When you enter in /rules, you are told some basic rules. You are also told to go on the internet and enter in the forums website, which can lead you to the rules here. It is up to y...

Pointless thread is weird and pointless. We all know dreaming has a wrongful relationship with Nel.

DNA sample, or it didn't happen. tagcatcgatcgatcgatcagctagcatgcggcgcgccgatcatatcgatcagctacgac tgactgtacgcatcgatcagcatcgactacgatagactacgacgacgactacgactgctg acgtacactgactgatcgactacgatcgatcgactagctagctacgatcgatagatatagc gctcgagagagagatctcgatcagctagcatcgatcgatcgactgactgactgactctcct cgatgagagagctagcatcg...

Just a little comment to everyone else. You will be surprised how many people don't care about you, so don't think you'll get puppy love From others writing a good bye thread.
Just leave quietly.

DNA sample, or it didn't happen.

Wireless from my basement, and receiving from my room on the top floor.

The world will end when we can no longer think of stuff to invent.

Jesse cook:

Tempest


Mario takes a walk

Stay tuned for a new spleef event!

I fix everything... My past job involved general contracting. That job requires you to do drywalling, mudding, electrical work, plumbing and everything else under the sun and moon. I dont understand much about how computers work. I must of missed the episode of The Magic School Bus when they were ta...

So what you are telling me is that you are making this story up about somebody letting you grief their own build. Now the story is that nobody gave you permission to grief this build. So you briefed the build out of spite. You are a builder. Being a builder requires you to have more responsibility. ...

As a Canadian, you speak better english than me. Unless it took you forever to iron out the kinks in your post.

As always, Welcome and have a great time.

Before i can investigate, i ask who told you it was ok to grief, and when did they tell you?

Sadly i choose McDonalds over Wendy's or burger king. A&W is so friggen salty, and their food is greasier than anyone out there. Wendy's used to be my choice but they slowly got worse and worse. Right now their hamburger buns are smothered in butter now. Burger king has always been the shittiest...

And this is a good test to see who the real trolls are these days.
A serious question? was asked and well...
Congrats, you failed the test.

http://beetlesinthebush.files.wordpress ... c31516.jpg

This was a great thread until the trolls came around.
Requesting a lock.

All it is, is a simple /kit that gives them the required items, and simple redstone wiring to get them into the action.

I saw this video on youtube and it looks very promising . It emphasizes on player strategy instead of running and smacking someone with a sword. They have come up with a class system that has different ways of fighting. A tank can take damage and heal a bit, and is capable of dealing low melee damag...

Do it!